Review
Similar Products
96
|
R&D Systems
tnfα Tnfα, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tnfα/product/R&D Systems Average 96 stars, based on 1 article reviews
tnfα - by Bioz Stars,
2026-02
96/100 stars
|
Buy from Supplier |
90
|
Elabscience Biotechnology
mouse mt elisa kit Mouse Mt Elisa Kit, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse mt elisa kit/product/Elabscience Biotechnology Average 90 stars, based on 1 article reviews
mouse mt elisa kit - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Twist Bioscience
anti-mouse cd3 mt fragments Anti Mouse Cd3 Mt Fragments, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-mouse cd3 mt fragments/product/Twist Bioscience Average 90 stars, based on 1 article reviews
anti-mouse cd3 mt fragments - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Jackson Laboratory
mt/mg mouse Mt/Mg Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mt/mg mouse/product/Jackson Laboratory Average 90 stars, based on 1 article reviews
mt/mg mouse - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
94
|
Cell Signaling Technology Inc
mouse atp5a1 cell signaling Mouse Atp5a1 Cell Signaling, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse atp5a1 cell signaling/product/Cell Signaling Technology Inc Average 94 stars, based on 1 article reviews
mouse atp5a1 cell signaling - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
90
|
Jackson Laboratory
mouse: rosa mt/mg  Mouse: Rosa Mt/Mg, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse: rosa mt/mg/product/Jackson Laboratory Average 90 stars, based on 1 article reviews
mouse: rosa mt/mg - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
93
|
Addgene inc
mouse gapdh 50 tgtagaccatgtagttgaggtca 30 hokkaido system science n a recombinant dna rosa26 mtmg addgene Mouse Gapdh 50 Tgtagaccatgtagttgaggtca 30 Hokkaido System Science N A Recombinant Dna Rosa26 Mtmg Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse gapdh 50 tgtagaccatgtagttgaggtca 30 hokkaido system science n a recombinant dna rosa26 mtmg addgene/product/Addgene inc Average 93 stars, based on 1 article reviews
mouse gapdh 50 tgtagaccatgtagttgaggtca 30 hokkaido system science n a recombinant dna rosa26 mtmg addgene - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
96
|
R&D Systems
tnf Tnf, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tnf/product/R&D Systems Average 96 stars, based on 1 article reviews
tnf - by Bioz Stars,
2026-02
96/100 stars
|
Buy from Supplier |
96
|
R&D Systems
mouse tnf α Mouse Tnf α, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse tnf α/product/R&D Systems Average 96 stars, based on 1 article reviews
mouse tnf α - by Bioz Stars,
2026-02
96/100 stars
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: Fine-tuning of Wnt signaling by RNA surveillance factor Smg5 in the mouse craniofacial development
doi: 10.1016/j.isci.2025.111972
Figure Lengend Snippet:
Article Snippet:
Techniques: TUNEL Assay, Recombinant, Software